ID: 901361362_901361366

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 901361362 901361366
Species Human (GRCh38) Human (GRCh38)
Location 1:8703414-8703436 1:8703433-8703455
Sequence CCGGGAGAGAAAGAGCAGACTCC CTCCCCGCGACGGCGGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 250} {0: 1, 1: 0, 2: 4, 3: 20, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!