ID: 901363786_901363787

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 901363786 901363787
Species Human (GRCh38) Human (GRCh38)
Location 1:8727798-8727820 1:8727812-8727834
Sequence CCACTATTCTTAAAGGTCAGCAG GGTCAGCAGTACTTCCCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 133} {0: 1, 1: 0, 2: 1, 3: 15, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!