ID: 901380622_901380632

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 901380622 901380632
Species Human (GRCh38) Human (GRCh38)
Location 1:8871457-8871479 1:8871510-8871532
Sequence CCATTCAGGGCAGGTCATTGGTT AAGAGGCTGATGATCTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95} {0: 1, 1: 0, 2: 2, 3: 22, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!