ID: 901443511_901443522

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 901443511 901443522
Species Human (GRCh38) Human (GRCh38)
Location 1:9293248-9293270 1:9293274-9293296
Sequence CCCCTCCCGCGGTGGCTCCGGGG CCTCCCTCGCCGCGGCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 154} {0: 1, 1: 0, 2: 1, 3: 26, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!