ID: 901443521_901443540

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 901443521 901443540
Species Human (GRCh38) Human (GRCh38)
Location 1:9293274-9293296 1:9293319-9293341
Sequence CCTCCCTCGCCGCGGCTCCTGGG CGCTGCCGCCGCTGCAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 333} {0: 1, 1: 0, 2: 4, 3: 45, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!