ID: 901453339_901453356

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 901453339 901453356
Species Human (GRCh38) Human (GRCh38)
Location 1:9349364-9349386 1:9349413-9349435
Sequence CCTGCTTGTGGCACGATGGGGCC GTAGGTGAGTGTGGGGTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83} {0: 1, 1: 0, 2: 6, 3: 36, 4: 503}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!