ID: 901453708_901453711

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 901453708 901453711
Species Human (GRCh38) Human (GRCh38)
Location 1:9351708-9351730 1:9351730-9351752
Sequence CCTGCACAGCAAGGAGGTGGCTA AGGTGTGAACAAAAGGAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 178} {0: 1, 1: 0, 2: 1, 3: 33, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!