ID: 901483064_901483079

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 901483064 901483079
Species Human (GRCh38) Human (GRCh38)
Location 1:9539469-9539491 1:9539510-9539532
Sequence CCCCGCCGGGCTCGCGCCGCAGA GGCCACGCCGCGGAAGGCGCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 6, 4: 90} {0: 2, 1: 0, 2: 0, 3: 10, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!