|
Left Crispr |
Right Crispr |
| Crispr ID |
901505291 |
901505299 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:9681343-9681365
|
1:9681359-9681381
|
| Sequence |
CCCTCCAGCCTCACCCTCTCAAG |
TCTCAAGCAGCTGGGACTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 37, 3: 500, 4: 2304} |
{0: 86, 1: 3841, 2: 56074, 3: 175019, 4: 257179} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|