ID: 901506687_901506694

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 901506687 901506694
Species Human (GRCh38) Human (GRCh38)
Location 1:9689731-9689753 1:9689761-9689783
Sequence CCACCTGTGCGGGCGTCTGCGGG TGCCCCGCCCCCAGCCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78} {0: 1, 1: 0, 2: 12, 3: 116, 4: 823}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!