ID: 901512550_901512557

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 901512550 901512557
Species Human (GRCh38) Human (GRCh38)
Location 1:9724686-9724708 1:9724702-9724724
Sequence CCCATTATCAGGGCAAGGGCAGG GGGCAGGTGTCCTTGGGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 220} {0: 1, 1: 0, 2: 2, 3: 43, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!