ID: 901514418_901514424

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 901514418 901514424
Species Human (GRCh38) Human (GRCh38)
Location 1:9735373-9735395 1:9735419-9735441
Sequence CCTTTCCTTACAGAAGGGGTTAG CAAGTGTCATTGGGCAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 106} {0: 1, 1: 0, 2: 1, 3: 22, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!