ID: 901523462_901523463

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 901523462 901523463
Species Human (GRCh38) Human (GRCh38)
Location 1:9803795-9803817 1:9803846-9803868
Sequence CCATCTTAAAAAAAATTAAATAA CAATGACATCAGCCATTTAAAGG
Strand - +
Off-target summary {0: 4, 1: 42, 2: 905, 3: 8620, 4: 112524} {0: 1, 1: 0, 2: 0, 3: 16, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!