ID: 901531072_901531079

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 901531072 901531079
Species Human (GRCh38) Human (GRCh38)
Location 1:9852847-9852869 1:9852864-9852886
Sequence CCCTGGATGCCCCAGGAGGGAAT GGGAATGGTGCATCTACAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219} {0: 1, 1: 0, 2: 0, 3: 4, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!