ID: 901532661_901532667

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 901532661 901532667
Species Human (GRCh38) Human (GRCh38)
Location 1:9863422-9863444 1:9863439-9863461
Sequence CCTCTGAGAGAAGCCTCCAAGCC CAAGCCACATGCGGGGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 155} {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!