|
Left Crispr |
Right Crispr |
| Crispr ID |
901542985 |
901542988 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:9932991-9933013
|
1:9933005-9933027
|
| Sequence |
CCTATAATCTCAACACTTTGGGC |
ACTTTGGGCGGATCACGAGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 252, 2: 6569, 3: 76254, 4: 362376} |
{0: 1, 1: 0, 2: 2, 3: 5, 4: 183} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|