|
Left Crispr |
Right Crispr |
| Crispr ID |
901560767 |
901560772 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:10068576-10068598
|
1:10068598-10068620
|
| Sequence |
CCTGACCTCGGGCCATCTGCCTG |
GCCTTGGCCTCCCAAAGTGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 18, 2: 697, 3: 11444, 4: 35120} |
{0: 52775, 1: 164492, 2: 216668, 3: 175886, 4: 111238} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|