ID: 901566246_901566251

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 901566246 901566251
Species Human (GRCh38) Human (GRCh38)
Location 1:10118240-10118262 1:10118258-10118280
Sequence CCCACTGGTTAGTTTCATATTTG ATTTGTAAAGGGCCTTCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 171} {0: 1, 1: 0, 2: 0, 3: 23, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!