|
Left Crispr |
Right Crispr |
| Crispr ID |
901583435 |
901583441 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:10265434-10265456
|
1:10265482-10265504
|
| Sequence |
CCATGTTACCCAGGTTGGTCTCG |
CACCTTGACCTCCCAAAGAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 12, 1: 982, 2: 50916, 3: 133028, 4: 214354} |
{0: 2, 1: 6, 2: 212, 3: 779, 4: 1702} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|