|
Left Crispr |
Right Crispr |
Crispr ID |
901583436 |
901583442 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:10265442-10265464
|
1:10265483-10265505
|
Sequence |
CCCAGGTTGGTCTCGAATTCCTG |
ACCTTGACCTCCCAAAGAGTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 48, 1: 1384, 2: 17107, 3: 63559, 4: 66620} |
{0: 2, 1: 172, 2: 4362, 3: 45466, 4: 151100} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|