ID: 901602149_901602160

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 901602149 901602160
Species Human (GRCh38) Human (GRCh38)
Location 1:10430673-10430695 1:10430707-10430729
Sequence CCCGGGCGCCCCCCGCGGCTGCG TTAACTGCCGCGGGTGGTGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 40, 4: 325} {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!