ID: 901635992_901636005

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 901635992 901636005
Species Human (GRCh38) Human (GRCh38)
Location 1:10670397-10670419 1:10670424-10670446
Sequence CCACAGCCTCCCGCCTAGGCATC AGTCAGGGGCGGGCGGCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 64, 4: 528} {0: 1, 1: 0, 2: 0, 3: 13, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!