ID: 901641432_901641437

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 901641432 901641437
Species Human (GRCh38) Human (GRCh38)
Location 1:10694887-10694909 1:10694912-10694934
Sequence CCGCCGGCGGCCGCGCGCGCGCT CATGCTGCCAGCGGCCGCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 47, 4: 256} {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!