ID: 901641433_901641440

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 901641433 901641440
Species Human (GRCh38) Human (GRCh38)
Location 1:10694890-10694912 1:10694933-10694955
Sequence CCGGCGGCCGCGCGCGCGCTCGC GGCCCCGCGAGCGCGACCGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 69, 4: 400} {0: 1, 1: 0, 2: 1, 3: 0, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!