ID: 901642948_901642956

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 901642948 901642956
Species Human (GRCh38) Human (GRCh38)
Location 1:10702273-10702295 1:10702310-10702332
Sequence CCTGCACCCTTTCAAGGAGCGCG GGTCCACAGAGGCCTCCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38} {0: 1, 1: 0, 2: 2, 3: 22, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!