ID: 901642983_901642985

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 901642983 901642985
Species Human (GRCh38) Human (GRCh38)
Location 1:10702423-10702445 1:10702448-10702470
Sequence CCTCCTGGGCTAGTGAAGGAGGA GATTTGCTCTGAGAAGCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 182} {0: 1, 1: 0, 2: 1, 3: 20, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!