ID: 901645998_901646006

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 901645998 901646006
Species Human (GRCh38) Human (GRCh38)
Location 1:10717043-10717065 1:10717068-10717090
Sequence CCCTAGAGAGACTCAGATGGGCT GCTGCTGGAGGGACAGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137} {0: 1, 1: 2, 2: 13, 3: 84, 4: 798}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!