ID: 901646803_901646806

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 901646803 901646806
Species Human (GRCh38) Human (GRCh38)
Location 1:10721130-10721152 1:10721151-10721173
Sequence CCTTGATTTATTTGCCTATTAAT ATTATCTTTCTGGCCAAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 619} {0: 1, 1: 0, 2: 1, 3: 22, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!