ID: 901653499_901653505

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 901653499 901653505
Species Human (GRCh38) Human (GRCh38)
Location 1:10756183-10756205 1:10756207-10756229
Sequence CCAGCCTGCACTTCTGCTCTCTC CGTTGCTGCCTCTGGAGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 62, 4: 623} {0: 1, 1: 0, 2: 0, 3: 12, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!