ID: 901653834_901653838

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 901653834 901653838
Species Human (GRCh38) Human (GRCh38)
Location 1:10757938-10757960 1:10757958-10757980
Sequence CCATCCACGTCCTGGCCACTCTG CTGCCTTTCTTTCCAGTCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 275} {0: 1, 1: 0, 2: 5, 3: 38, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!