ID: 901687225_901687233

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 901687225 901687233
Species Human (GRCh38) Human (GRCh38)
Location 1:10949645-10949667 1:10949683-10949705
Sequence CCGGTGCAGGAGGTCCCGAGAAA CTGGTCCTGCAGCCCACACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78} {0: 1, 1: 0, 2: 4, 3: 39, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!