ID: 901687276_901687286

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 901687276 901687286
Species Human (GRCh38) Human (GRCh38)
Location 1:10949873-10949895 1:10949899-10949921
Sequence CCCTGCTGAAGGGACCATGAGTG CCTTTTCCACAGGTGGGGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 148} {0: 1, 1: 0, 2: 2, 3: 34, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!