ID: 901702893_901702898

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 901702893 901702898
Species Human (GRCh38) Human (GRCh38)
Location 1:11054858-11054880 1:11054871-11054893
Sequence CCTGGGCTCAGCTCACATCATTC CACATCATTCAGGGCCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 242} {0: 1, 1: 0, 2: 4, 3: 22, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!