ID: 901706210_901706214

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 901706210 901706214
Species Human (GRCh38) Human (GRCh38)
Location 1:11075304-11075326 1:11075325-11075347
Sequence CCACCACGCCAGGCCTGAAATTT TTAGTATTACATATCTTTATAGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 230, 3: 1552, 4: 7780} {0: 1, 1: 0, 2: 1, 3: 32, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!