ID: 901718916_901718925

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 901718916 901718925
Species Human (GRCh38) Human (GRCh38)
Location 1:11179516-11179538 1:11179564-11179586
Sequence CCCTCTGTCCTTTTGGCCAGCTT TTCTTACAATTCCTCGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 227} {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!