ID: 901725040_901725048

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 901725040 901725048
Species Human (GRCh38) Human (GRCh38)
Location 1:11235084-11235106 1:11235108-11235130
Sequence CCTGTTTTCCCCAGTCATAGCAG CCACAGGGAAAAGAAATGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 201} {0: 1, 1: 0, 2: 7, 3: 58, 4: 741}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!