ID: 901726005_901726010

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 901726005 901726010
Species Human (GRCh38) Human (GRCh38)
Location 1:11242621-11242643 1:11242641-11242663
Sequence CCCTCGCCTTAGCGAAGACACCC CCCCAGTCTCTCCATCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32} {0: 1, 1: 0, 2: 1, 3: 37, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!