ID: 901726005_901726013

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 901726005 901726013
Species Human (GRCh38) Human (GRCh38)
Location 1:11242621-11242643 1:11242650-11242672
Sequence CCCTCGCCTTAGCGAAGACACCC CTCCATCTGGCAGGATGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32} {0: 1, 1: 0, 2: 4, 3: 31, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!