ID: 901740900_901740909

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 901740900 901740909
Species Human (GRCh38) Human (GRCh38)
Location 1:11341124-11341146 1:11341171-11341193
Sequence CCTCACTTAATCATTCAACACAC CAGACCGCATCCCAGGCTCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!