ID: 901762171_901762182

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 901762171 901762182
Species Human (GRCh38) Human (GRCh38)
Location 1:11478667-11478689 1:11478698-11478720
Sequence CCGGGGATGCCCGCGAGTGTCCA GTGACCTGCCAAGGCTGGGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 19, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!