ID: 901772501_901772515

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 901772501 901772515
Species Human (GRCh38) Human (GRCh38)
Location 1:11537415-11537437 1:11537463-11537485
Sequence CCTCATGGATCTAAGCCCCTGTC TTTTGGGGGATGGCCCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100} {0: 1, 1: 0, 2: 0, 3: 18, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!