ID: 901783184_901783189

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 901783184 901783189
Species Human (GRCh38) Human (GRCh38)
Location 1:11608143-11608165 1:11608160-11608182
Sequence CCCACGGGGCTTCATGGAGAGGA AGAGGAGGGAAAGAAGGAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 28, 3: 297, 4: 2208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!