ID: 901783924_901783932

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 901783924 901783932
Species Human (GRCh38) Human (GRCh38)
Location 1:11612138-11612160 1:11612179-11612201
Sequence CCTGGGCAGCTAGCCAGGGTGGG AGAGGAGAGAGAAGAAGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!