ID: 901797940_901797945

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 901797940 901797945
Species Human (GRCh38) Human (GRCh38)
Location 1:11691492-11691514 1:11691505-11691527
Sequence CCCGCGCCCTCGCGGCGGCGGCG GGCGGCGGCGCCTAGGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 369} {0: 1, 1: 0, 2: 0, 3: 23, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!