ID: 901798292_901798307

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 901798292 901798307
Species Human (GRCh38) Human (GRCh38)
Location 1:11692693-11692715 1:11692738-11692760
Sequence CCTGCCCTATATGCTCCCTCCAC GACACACTGGTGTCTGGAACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 233} {0: 1, 1: 0, 2: 0, 3: 21, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!