ID: 901798299_901798307

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 901798299 901798307
Species Human (GRCh38) Human (GRCh38)
Location 1:11692721-11692743 1:11692738-11692760
Sequence CCACCTCCCAGCCCAGTGACACA GACACACTGGTGTCTGGAACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 528} {0: 1, 1: 0, 2: 0, 3: 21, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!