ID: 901807935_901807943

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 901807935 901807943
Species Human (GRCh38) Human (GRCh38)
Location 1:11749629-11749651 1:11749652-11749674
Sequence CCTTGTACCTGGGAGGGGAGCTG GAGAGGAGTGCGTGGGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 274} {0: 1, 1: 1, 2: 1, 3: 26, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!