ID: 901810142_901810145

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 901810142 901810145
Species Human (GRCh38) Human (GRCh38)
Location 1:11762721-11762743 1:11762749-11762771
Sequence CCTAGCACGGTTGTCATTTATTC GCATTTACAAGCCCCTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131} {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!