ID: 901820159_901820164

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 901820159 901820164
Species Human (GRCh38) Human (GRCh38)
Location 1:11823790-11823812 1:11823820-11823842
Sequence CCTGCTCTGCAAGGTCCTTGGAG CAGTGTGGCTGGAGGTAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 207} {0: 1, 1: 0, 2: 3, 3: 66, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!