ID: 901825466_901825473

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 901825466 901825473
Species Human (GRCh38) Human (GRCh38)
Location 1:11858436-11858458 1:11858463-11858485
Sequence CCGACAGTTTGCCCTGCAAATGG GCTGCTCCTGCAATGAATGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 125} {0: 1, 1: 0, 2: 3, 3: 12, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!